Important and the most studied lipopeptides from
Abstract
Lipopeptides constitute an important class of microbial secondary metabolites. Some lipopeptides have potent therapeutic activities such as antibacterial, antiviral, antifungal, antitumor and immunomodulator. Surfactin, iturin, fengycin, lichenysin and bacillomycin D from Bacillus species, daptomycin from Streptomyces roseosporus and rhamnolipids from Pseudomonas aeruginosa are among the most studied lipopeptides. These molecules are good candidates to replace those antibiotics and antifungals with no effect on pathogenic microorganisms. Microbial lipopeptides are produced via fermentation processes by bacteria, yeast and actinomycetes either on water miscible and immiscible substrates. However, the major bottlenecks in lipopeptide production are yield increase and cost reduction. Improving the bioindustrial production processes relies on many issues such as selecting hyperproducing strains and the appropriate extraction techniques; purification and identification by Polymerase Chain Reaction(PCR), High Performance Liquid Chromatography-Mass Spectrometry(HPLC-MS), Matrix Assisted Laser Desorption Ionization-Time of Flight-Mass Spectrometry(MALDI-TOF-MS); the use of cheap raw materials and the optimization of medium-culture conditions. The purpose of this chapter is to orient the reader on the key elements in this field, including the selection of analytical strategies to get a good microbial strain as well as to show some examples of liquid and solid-state low-cost fermentation processes. Last, we introduce endophytic bacteria as lipopeptide-producer candidates.
Keywords
- endophytic bacteria
- fermentation
- lipopeptide-producers
- microbial lipopeptides
- quorum sensing
1. Introduction
In recent years, the production of microbial lipopeptides (LPs) has been widely studied for their biotechnological application in several areas including pharmaceutical industry, food preservation and agriculture. Lipopeptides are characterized for their highly structured diversity and their ability to decrease the surface and interfacial tension. Structurally, they consist of a hydrophilic peptide and a hydrophobic fatty acid acyl chain. The number of amino acids generally varies from 7 to 25, whereas the length of the fatty acid chains varies from 13 to 17 carbons. One strain is able to produce several isoforms of the same polypeptide.
Lipopeptide surfactants are naturally produced as mixtures of several macromolecules belonging to the same family or class. The nutritional parameters can influence the nature of the produced LPs [6]. However, the major limitations on their production are the production costs and yields. A wide range of carbon sources and culture conditions have been reported in order to increase the production of iturins, surfactins and fengycins. Nowadays, a variety of cheap raw materials have been used in their production: rice bran, soybean, potato peels, molasses, etc. In addition, it has been demonstrated that divalent cations have an important influence on LP production, mainly Mn2+ and Fe2+. The manganese addition to the medium culture increased yield rates from 0.33 to 2.6 g/L [7]. Furthermore, the presence of ZnSO4, FeCl3 and MnSO4 increased surfactin production in
Another important issue to address here relates to the microbial-producing strains. The genetic load of the microorganisms is a determining factor on LPs production yields, since the capacity to generate a metabolite is controlled by genes. There is a need for hyperproducer strains. But how can we recognize these over producing microbes? Lipopeptides production can be detected by: (i) culture dependent methods; (ii) methods relying on surface analysis and emulsifying activity; (iii) cell surface hydrophobicity and (iv) chemical identification [9]. An optimal and widely accepted study must combine the genetic identification and the structural and genetic analysis of the produced LPs by the particular isolate. This methodology assures the phenotypic and genotypic features of the microbial isolates for LPs production. Currently, the PCR and gene sequencing are quick tools for screening and identification of microbial-producers, as well as to identify the genes involved in the LPs synthesis. Also, the isolation and identification techniques such as liquid chromatography coupled to mass spectrometry (LC-MS) and more recently the MALDI-TOF mass spectrometry, have been considered as the fastest and most efficient tools for identification of LPs in mixtures and peptide sequencing, respectively. These techniques are also useful to identify the most novel LPs and even the small compositional changes in the sequence of amino acids that will determine its properties. There is no doubt, that these tools will increase and incentive the development of this field in fermentation processes.
In our lab, we are particularly interested in bacterial endophytes. By definition, an endophyte is a bacteria or fungus that lives in the internal tissues of plants without disease manifestation. Endophytes are ubiquitous to virtually all-terrestrial plants. With the increasing appreciation of studies that unravel the mutualistic interactions between plant and microbes, functions of endophytes are gaining value, so these microorganisms have become the target of biotechnological developments for biological control of plant pathogens (fungi and bacteria). We have evidence that a large group of endophytic bacteria have the ability to eradicate their competitors (pathogens) from the niche using LPs. In this chapter, we are interested in discussing endophytic microorganisms known as lipopeptide-producers beyond the genus
Finally, it must be considered that the production of biosurfactants is associated with the physiological status of the bacteria, where quorum sensing (QS) is probably a condition. Quorum sensing is perhaps an overlooked variable in fermentation processes. In this chapter, we try to explain how this phenomenon and other conditions can alter the performance of LP production.
2. Lipopeptides: classes, microbial producers, fermentation processes and downstream processes
2.1. Classes of lipopeptides and their applications
The production of LPs in their active form requires transcriptional induction, translation and post-translational modifications. The main machinery for their synthesis is multi-modular and consists of non-ribosomal peptide synthetases (NRPSs) [10]. Synthetases are organized on modules; each module permits the incorporation of a specific amino acid, subsequent condensation, termination and cyclization of the peptide chain. The synthesized peptides contain d-amino acids, β-amino acids and hydroxyl- or
Lipopeptides | Activity roles | ||
---|---|---|---|
Surfactin family | Surfactin linchenysin pumilacidin WH1 fungin | -Enhanced oil recovery Antibacterial Antiviral Antimycoplasma Antitumoral Anticoagulant Enzyme inhibition |
|
Iturin family | Iturin Bacillomycins Mycosubtilin Subtulene (contains a unique Iso C15-long chain |
-Antifungal -Biopesticides |
|
Fengycin family | Fengycin Plipastatin Agrastatin1 |
-Strong fungitoxic agent against filamentous fungi -Immunomodulating activities |
|
Viscosin Massetolide Entolysin |
-Antibacterial and Antifungal activity against; |
||
Daptomycin | -Broad spectrum activity against –MRSA -Antiparasitic -Immunosuppressor |
Table 1.
Many bacteria and some fungi produce LPs, which have several roles including activity against bacteria, fungi, virus and more recently, it has been discovered their antitumor activity. Lipopeptides are also are involved in bacterial motility, in the swarming behavior and in the attachment to surfaces [1]. On the other hand, the extensive use of chemicals to control pathogens (bacteria and fungi) has modified the behavior of these microorganisms in humans and plants. The growing drug resistance, in these pathogens, urges for alternative antimicrobial molecules for clinical and crop protection, as well as for food preservation. As we mentioned above, LPs can be cyclic or linear based on the topology of the peptide chain. Here, we present an updated overview on the bioactive LPs and their uses, being the cyclic lipopeptides the most biologically relevant with proved activity and more market applications in several fields. The characteristics of the LPs are discussed below, and their properties, structures and uses have been summarized in Table 1 and Figure 1.
![](http://cdnintech.com/media/chapter/51664/1512345123/media/fig1.png)
Figure 1.
Pharmaceutically and economically important lipopeptides. Structures of representative member of lipopeptide synthesized by
2.2. Endophytic bacteria as lipopeptide-producers
Due to the nature of the endophytic life style, endophytic microbes establish a long-lasting stable relationship with the plant. In this symbiotic association, the plant provides nutrients and shelter for the microbes and, in turn, the endophyte benefits plants by imparting biotic and abiotic stress tolerance and promoting its growth. Some endophytes are known to produce anti-pest compounds. These bioactive secondary metabolites can be either directly involved in antibiosis and/or triggering induced systemic resistance (ISR). There have been published some reports of the production of LPs by endophytic bacteria that may explain the antifungal or antibacterial activity on plant pathogens. Recently, Gond et al. reported an endophytic
Endophytic lipopeptide-producers | Secreted lipopeptides | ||
---|---|---|---|
Surfactin | Iturin | Linchenysin | |
Pumilacidin | Bacillomycins | Mycosubtilin | |
Fengycin | Plipastatin | ||
Surfactin | Linchenysin | Pumilacidin | |
Fengycin | |||
Surfactin | Linchenysin | Pumilacidin | |
Iturin | Bacillomycins | Mycosubtilin | |
Subtulene | Fengycin | Plipastatin | |
Fengycin | Plipastatin | Iturin | |
Surfactin | Iturin | Fengycin | |
Polymyxin | |||
Surfactin | Iturin | Fengycin | |
Daptomycin | |||
Viscosin | Massetolide | Entolysin |
Table 2.
Endophytic bacteria reported as lipopeptide-producers.
2.3. Lipopeptide production by fermentation process: culture conditions and operational conditions
In order to incorporate LPs into industrial processes and for medical, pharmaceutical and agricultural uses, it is required their production by fermentation and their posterior downstream. It is clear that one of the main limitations for commercial applications of LPs are the high production costs and the low yield. To overcome these barriers, many efforts have been focused in improving the fermentation process, which represents a fundamental stage in the global production. Lipopeptides have been reported as growth-associated metabolites. In contrast to other bacterial secondary metabolites, production of LPs is induced when the cells have exhausted one or more essential nutrients, in example, surfactin production is induced in actively growing cells during the transition from exponential to stationary phase (SP); fengycin synthesis is related to the early SP, and iturins only accumulate in the later SP [1].
The production of LPs can be achieved by liquid fermentation (LF) or solid-state fermentation (SSF) and now, both methods have been proposed for scale up their industrial production. The LF is an advantageous and typical process used for LPs production in controlled bioreactors, while SSF is still in evolution but has gained attention owing its priority to LF, including lower investment for production, less time and higher secondary metabolite yields.
A critical factor into industrial LP production is media optimization. In fact, the nature of the carbon substrate, N, P, Na, Mg, Fe, Zn and Mn ions concentration in the medium, have been shown to influence enormously the nature and quantity of the LP produced by several bacterial strains. An orderly and planned statistical procedure to screen the effect of each component of the media is very useful. For example, a Plackett-Burman procedure was applied to find that glucose, K2HPO4, and urea concentrations had the most influence into LPs production by
2.3.1. Carbon sources to optimize lipopeptide production
It is clear the importance of carbon source in any fermentation process due to its impact in the bacterial metabolism as well as in production costs. The nature and quantity of the carbon source are the most important factors that would affect LPs production. Structural and compositional diversity of LPs is substrate dependent. For example,
2.3.2. Nitrogen sources
Several inorganic nitrogen compounds have been tested in LP production trials, i.e. ammonium nitrate, ammonium sulphate, sodium nitrate, urea and glutamic sodium. And looking for cheaper raw materials, complex compounds such as soybean flour, peptone and casein acid hydrolysate have been assayed too [27]. When using organic nitrogen sources it was observed that tryptone enhances the lipopeptide production because it contains several homologous L-amino acids to those found in LPs [30]. A similar behavior was reported in the modified Landy medium, where l-glutamic acid was replaced with various L-α-amino acids at the same concentration (5 g/L). Cottonseed-derived medium (Pharmamedia) proved to be a suitable substrate for the production of 220 mg/L of surfactin from
2.3.3. Divalent ions
To optimize the trace element composition of culture media the use of statistical experimental designs is preferred. Such is the case, where was doubled surfactin concentration when was applied the statistical method Taguchi to determine cation effect of culture medium [33]. The role of Fe2+ in the synthesis of LPs is crucial; there are some reports where the supplementation of this cation enhanced the yield of biosurfactants [31, 33]. The addition of Fe2+ into fermentation medium was utilized to optimize surfactin production from
2.3.4. Operational conditions
The pH, temperature, dissolved oxygen concentration and degree of aeration affect cellular growth, and consequently, biosurfactant production. Optimal operational conditions vary from strain to strain, and the better growing condition for each particular strain must be determined experimentally. For example, surfactin synthesis by
Statistical tools had been used to optimize LP biosynthesis considering operational conditions. The response surface methodology has been used to determine the maximum LP production varying the temperature, initial pH and culture cycle. Another important condition to be controlled is the dissolved oxygen. The oxygen acted at different levels, suggesting a complex system for regulating the synthesis of LP in B.
Classical bioreactors aerated by gas bubbling are not suitable for production of LP biosurfactants due to excessive foaming. The use of antifoam agents is not appropriate because it can affect the bacterial physiology and downstream processing. The alternatives are bioreactor with foam collector, rotating discs biofilm reactor [38], bubbleless membrane aerated bioreactor [39] and three-phase inverse fluidized bed bioreactor [40]. Another alternative to foam control is the use of a strictly anaerobic bioreactor cultivation to produce surfactin. Most interesting, the product yields exceeded classical aerobic fermentations, in which foam fractionation was applied. Additionally, values for specific production rate surfactin (0.005 g/(g h)) and product yield per consumed substrate (
2.4. Solid-state fermentation (SSF)
Solid-state fermentation (SSF) is an alternative technology for the production of high-value molecules. The SSF could be an alternative method for the LPs production. The SSF uses agro-industrial wastes as substrates, which contributes to reduce the production costs. The productivity of LPs synthetized by SSF depends on initial moisture content, incubation temperature, fermentation time, substrates used and supplementary nutrients such as mineral salts. The temperature is an important parameter for both bacterial growth and LP production. Within a range from 25 to 40°C, the optimal temperature for growth was found to be 30°C, but the biosynthesis of LPs is favored at 37°C. At the beginning, in the firsts 24 h, temperature should be maintained at 30°C, then shifted up to 37°C to enhance LP production [42].
The selection of raw materials to formulate a culture medium, as the previously described, requires experimental tests. Savings in time and resources can be achieved using statistical methods, which help in optimizing components and concentrations in the formulation of a culture medium. The optimal composition of culture medium in solid-state fermentation to get the highest LP production had been determined using a ‘Central Composite Design’. First, a screen to select the major solid substrates was performed, where rapeseed meal, corn flour, soybean flour, bean cake, wheat bran, rice hull and rice straw were considered as candidates to support bacterial growth and biosurfactant production. For the election, a quantity of each solid substrate was supplemented with 1.0 ml of mineral solution with initial pH 7.5 and moisture content 55%. To increase the porosity of the substrates and improve its availability, each of them was mixed with an inert substrate (perlite, vermiculite, beads). After that, both easily digestible carbon sources (glucose, sucrose, starch, l-glutamic, maltose, glycerol, d-galactose) and nitrogen sources (tryptone, peptone, yeast extract, urea, NH4NO3, NH4Cl, (NH4)2SO4 at 2% (w/w) were added. The substrates selected to the optimization of the medium composition for LP production by ‘Response Surface Methodology’ were soybean flour, rice straw, starch and yeast extract. The optimal conditions were 1.79% starch and 1.91% yeast extract by employing 5.58 g soybean flour and 3.67 g rice straw as the solid substrate with initial pH 7.5, moisture content 55% and a 10% inoculum level at 30°C for 2 days. Under these conditions, the experimental yield of LPs reached 50.01 mg/gram of dry substrates [43]. SSF many times is compared with submerged fermentation. By this reason, a comparative study was performed to determine the compositions and properties of LP products purified and the transcription values of LP genes under submerged fermentation and SSF. Results revealed no significant differences in the polarity and structure of the two LP products. But, LP obtained by submerged fermentation possessed higher amino acid proportions, better emulsification activity and antagonistic activity than that from solid-state fermentation. For solid-state fermentation, the transcription accumulation levels of the LP synthetic genes srfA and sfp were higher than for submerged fermentation at the same stage. Transcripts for ituD and lpa-14 remained elevated for a longer period of time under solid-state fermentation conditions, accounting for differences in the production and fermentation periods between both fermentation techniques [44].
2.5. Downstream processing: isolation and purification of lipopeptides from fermentation process
Due to different applications of LPs, we need different levels of purity. Crude LPs can straightaway be used in bioremediation related applications, where the overall economy of the process is the most important concern. On the other hand, partially purified fractions (about 60–80% pure) can suit applications in microemulsion based nanoparticle synthesis, laundry and food industry. However, the requirement for ultrahigh pure product is indispensable, if the LPs are to be considered for pharmaceuticals and human healthcare [45]. As we mentioned before, the intense foaming produced during aerobic liquid fermentation is a big obstacle for the commercialization making their recovery and purification difficult. A great deal of monetary input will be required for purification, this account 60% of the total production cost. Different techniques have been developed to extract and purify LPs. Among the most used techniques to extract are acid precipitation (HCl 6N), solvent extraction (chloroform, ethyl acetate, dichloromethane or mixtures of chloroform-methanol), ammonium sulphate precipitation with dialysis to remove small molecules and salts, and foam fractionation (utilized for continuous retention process and high purity). For purification normally have been used membrane ultrafiltration techniques, ionic exchange chromatography and adsorption-desorption on resins (XAD-4, XAD-7 HP, HP-2MG, HP-20) or activated carbon. The High Performance Liquid Chromatography(HPLC) (an excellent method for separation of this class of molecules) uses a reverse phase with C18 columns. The LPs separated can be detected using ultraviolet absorbance or diode arrays detectors and each peak separated is collected using a fraction collector for further analysis of their structure.
2.5.1. Example of techniques used for lipopeptide recovery, purification and identification
A two-step ultrafiltration process using large pore size membranes (up to MWCO = 300 kDa) was investigated to separation of LPs aggregated in single and mixed solutions from fermentation culture. In single solutions of LP both surfactin and mycosubtilin formed micelles of different size depending on their concentration. However when the LPs were in the same solution, they formed mixed micelles of different size and probably conformation to that formed by the individual LPs, this prevents their separation according to size. An effective rejection in the first ultrafiltration step was achieved by membranes with MCWO= 10–100 kDa but poor rejection by the 300 KDa membrane [46]. The rejection is a measure of retention capacity of a membrane. However, some properties of LP micelles such as poor stability and non-uniform size distribution limit the use of readily scalable high MWCO membranes for the purification of LP, as smaller sized micelles and monomers can easily pass through the pores of these membranes. An addition of Ca2+ ions causes the structural transformation of surfactin monomers to larger micellar aggregates, showing excellent features such as compact structure, narrow size distribution, and improved stability [45].
2.5.2. HLPC-MALDI-TOF
HPLC is an excellent method for the separation of individual LP separation. The most employed technique is reverse phase chromatography, due to this method can separate this metabolite based on its polarity. The separated products are detected by UV absorbance detection and each individual peak can be collected for further analysis of their structure. Also, use of a diode array detector is recommended. This detector can measure simultaneous wavelengths in a range of 200–600 nm, this means that we can detect LPs as they are eluted from the column in several wavelengths. For mobile phases reported, the methanol:water (80:20) is the most commonly employed, due this phase can elute several LPs as fengicins and iturins. Also, another mobile phase used is acetonitrile:water, as the methanol:water phase, this mobile phase can elute LPs as surfactins. The proportions for a acetonitrile:water can change depending on the LP that you want to separate. The typical column for LP’s separation is a C-18 column, the length can vary from 150 to 250 mm, and this depends on the resolution and separation desired. In terms of particle size, 5 μm is the most adequate for the stationary phase. Table 3A shows some conditions of HPLC most widely used for separation as well as quantification of LPs derived from a fermentative process [49, 50].
MALDI-TOF (matrix-assisted laser desorption/ionization-time of flight) is a mass spectrometry technique that allows the identification of intact compounds. Samples to be analyzed are mixed with a matrix and dried on a stainless steel plate, onto which a laser with various degrees of energy is fired to forming gaseous ions, which can be separated in a time of flight (TOF) analyzer and detected. Now, MALDI-TOF-MS has come to be regarded as a very fast and reliable tool for identification of LPs when compared to the conventional methods like culturing and purifying the LPs. The MALDI-TOF-MS for the identification of LPs has been previously reported [51, 52]. For LP identification, we can use CHCA (α-cyano-4-hydroxycinnamic acid), SA (sinapic acid) and DHB (2,5-dihydroxybenzoic acid). To the best of our knowledge, DHB matrix is better than CHCA, because we obtain a good quality spectra with intensities above 2E4 and LP isomers can be observed. In Table 3B are shown relevant information of the mass range for specific LPs identification derived from MALDI-TOF analysis.
COLUMN | C-18, 150mm– 250mm length, size particle 5μm |
ITURIN, FENGYCIN SURFACTIN AMPHISIN LOKISIN HODERSIN, TENSIN VICOSINAMIDE DAPTOMYCIN VISCONSIN MASSETOLIDE ENTOLYSIN |
|
MOBILE PHASE | Methanol: water (80:20), (80:20 and 40:60), acid (68:32) |
||
RETENTION TIMES |
3-10 min iturin 10-16 min fengycin 16-25 min surfactin 28.5 min amphisin 29 min lokisin 29.2 min hodersin 29.9 min tensin 31.6 min vicosinamide |
||
DETECTORS | UV-VIS ( 278, 285nm), diode array. |
||
1016.56, 1030.58, 1044.59, 1058.61, 1072.62; 1030.64, 1044.65, 1072.67 |
ITURIN A | ||
1122.47, 1136.55; 1080.59 |
BACILLOMYCIN | ||
1435.58, 1449.63, 1421.61, 1435.66, 1459.69, 1477.72; 1421.75, 1435.76, 1449.77, 1491.81 |
FENGYCIN | ||
1516.62; 1502.72; 1502.79 |
FENGYCIN (POTASSIUM ADDUCT) |
||
1102.55 |
BACILLOMYCIN (SODIUM ADDUCT) |
||
1499.71, 1513.71; 1471.75, 1499.77, 1513.79 |
FENGYCIN (SODIUM ADDUCT) |
||
878.47, 892.41, |
KURSTAKINS | ||
1202.75, 1188.73, 1143.70, 1168.77, 1154.75 |
POLYMYXINS | ||
1421.75, 1407.73, 1393.72, |
BACITRACINS |
Table 3.
HPLC strategies and conditions (A) used for lipopeptides separation from extracts of culture filtrate and (B) ranges of m/z of typical peaks obtained by MALDI-TOF analysis. In bold, the reference peaks for lipopeptide identification.
2.6. Discovery of endophyte-producers of lipopeptides: combining molecular biology and chromatographic- mass spectrometry methods
To search for endophytic bacteria in nature that can produce LPs, researchers must optimize their screening and identification times. Actually, the strategies for the selection of endophytic microorganisms as candidates for biocontrol or lipopeptide-producers combines antifungal-antibacterial screenings, a molecular analysis of the genes involved in the LP synthesis and then an analysis of the extracts obtained from the culture medium by HPLC and mass spectrometry.
In practice, after endophyte isolation, we identify the purified strain by MALDI-TOF and confirm its identity by 16s rDNA sequencing. Once identified, we select the strain as a function of its antagonistic ability against plant pathogenic strains. For screening antifungal activity of the isolates, we use a dual culture test against fungal strains collected from plants and previously identified. Normally, the plates are incubated for 3–5 days to observe inhibition of the fungal mycelium (Figure 2). For screening the presence of LP product biosynthetic gene clusters present in the antifungal isolate, PCR-based screening methods are used for different genes involved. In Table 4, we show the summarized sequences and methods for PCR analysis most used for some lipopeptide-genes, then each amplification product is analyzed by agarose gel electrophoresis to compare the predicted base-pair number (Figure 3). The sequence data obtained must be analyzed by BLAST and detailed
![](http://cdnintech.com/media/chapter/51664/1512345123/media/fig2.png)
Figure 2.
Antagonism of endophytic
PCR++ | |||||
---|---|---|---|---|---|
Iturin | ituD ituC ituA |
ITUD-F1 ITUD-R1 ITUC-F1 ITUC-R1 ITUD1F ITUD1R |
TTGAAYGTCAGYGCSCCTTT TGCGMAAATAATGGSGTCGT CCCCCTCGGTCAAGTGAATA TTGGTTAAGCCCTGATGCTC GATGCGATCTCCTTGGATGT ATCGTCATGTGCTGCTTGAG |
55 55 55 |
482 594 647 |
Surfactin | srfA srfP srf/Ich |
SRFA-F1 SRFA-R1 SFP-F1 SFP-R1 As1-F Ts2-R |
AGAGCACATTGAGCGTTACAAA CAGCATCTCGTTCAACTTTCAC ATGAAGATTTACGGAATTTA TTATAAAAGCTCTTCGTACG CGCGGMTACCGVATYGAGC ATBCCTTTBTWDGAATGTCCGCC |
55 52 43 |
626 675 428 |
Mycosubtilin | Myc/itu | Am1-F Tm1-R |
CAKCARGTSAAAATYCGMG CCDASATCAAARAADTTATC | 45 | 419 |
Fengycin | fen | Af2-F Tf1-R |
GAATAYMTCGGMCGTMTKGA GCTTTWADKGAATSBCCGCC | 45 | 452 |
Piplastin | pps | Ap1-F Tp1-R |
AGMCAGCKSGCMASATCMCC GCKATWWTGAARRCCGGCGG |
58 | 1029 |
Table 4.
PCR primers commonly used for amplification of lipopeptide genes.
*AT: ANNEALING TEMPERATURE (°C).
+PCR: PCR PRODUCT SIZE EXPECTED (bp).
The crude extracts obtained from culture media must be subject to HPLC separation and their collection for mass identification. The chromatographic profile of acidic methanol extracts and MALDI-TOF spectra of LPs from endophytic
![](http://cdnintech.com/media/chapter/51664/1512345123/media/fig3.png)
Figure 3.
Agarose gel electrophoresis of PCR products of Bacillus endophytes (Below left) and separation and identification of the antifungal lipopeptides from acidic methanol extract by using reversed-phase HPLC(Above left) and MALDI-TOF MS analysis (Right)
Section 2: PCR detection of lipopeptide and biosynthesis genes from Bacillus amyloliquefaciens (A), B. tequilensis (B), B. subtilis (C). M DNA ladder, Lane 1 Subtilosin, Lane 2 Sublancin, Lane 3 Plipastatin, Lane 4 Iturin D, Lane 5 Iturin C, Lane 6 Iturin A, lane 7 Surfactin A, Lane 8 Surfactin F, Lane 9 Mycosubtilin, Lane 10 Fengycin, lane 11 Subtilin A Lane 12 Ericin and Lane 13 Surfactin P.
Chromatogram profile and MALDI-TOF mass spectrum of B.
2.7. Quorum sensing in fermentative processes and lipopeptide production
Quorum sensing (QS) is a form of cell-cell communication by which bacteria communicate by secreting signaling molecules called autoinducers that help regulate gene expression. The QS molecule as N-acylhomoserine lactones in Gram-negatives or AIP in Gram-positives regulates different bacterial functions such as antibiotic biosynthesis, production of virulence factor, bacterial swarming, sporulation, competence and transition to the stationary growth phase.
How are LP production and quorum sensing associated? Surfactin a LP widely mentioned in this chapter book was proposed as a quorum-sensing molecule that activates the process of sporulation and production of biofilm [53]. For regulation of surfactin production by a cell density-responsive mechanism
Fermentation processes in terms of batch fermentation constituted a molecular black box in regards to transcriptional activity of the genes of LP synthesis circuitry in both Gram-positive and Gram-negative bacteria. More studies of the molecular biology during fermentation of LPs are needed. Monitoring gene expression of LPs over the entire time course of the fermentation process provides information about regulatory events linked or not to QS. QS is a variable that has largely been ignored in fermentative process studies. It is likely that information on QS in fermentation will help optimize bioreactor conditions, nutrient limitations or perhaps the use of signal molecules of QS to improve production yields of LPs and other microbial products.
3. Conclusions
The examples discussed so briefly in this chapter are by no means exhaustive. Hopefully they serve to illustrate the potential use of bacterial LPs and highlight potential applications in fields of biomedicine and agriculture. We also emphasize the potential of endophytic bacteria as lipopeptide-producers, opening research opportunities to understand some of the mechanisms involved in the biological control that occurs in niches they inhabit as endophytes. Knowledge of this and other topics, will promote the implementation of new molecules that are harmless to humans when we cannot directly apply bacteria in agricultural fields. It is clear that for widespread use of microbial LPs, more research is required focused on production with higher yields and at lower cost, where solid-state fermentation emerges as an important area of study in fermentation processes. This field is very much in its early stages, and progress will come from a combination of ecological, physiological, structural, genetic and fermentative process approaches.
Acknowledgments
TThe authors gratefully acknowledge the financial support from CONACYT: Proyectos de Desarrollo Cientifico para atender Problemas Nacionales (CONACYT 212875) and Project 207400 of Bilateral Cooperation Mexico-Brazil funded by CONACYT and CNPq (Brazil, No. 490440/2013-4). FAPESP (Fundação de Amparo à Pesquisa do Estado de São Paulo; No. 2012/12663-1; CEPID Redoxoma (FAPESP; No. 2013/07937-8)), Universidade de São Paulo NAP Redoxoma (PRPUSP; No. 2011.1.9352.1.8) .G M-R, thanks CONACYT for PhD fellowship #256660. EB-G, AM-R and YY C-C thanks to Universidad Autonoma de Guadalajara for their scholarships. Finally we thanks to Professor James F. White Jr. from RUTGERS University for providing valuable suggestions and English revision of manuscript.
To the memory of Professor Tetsuya Ogura who passed away recently, whose works and gentle encouragement have had the most profound influence on my scientific career.
References
- 1.
Ongena M, Jacques P. Bacillus lipopeptides: versatile weapons for plant disease biocontrol. Trends Microbiol. 2007;16 (3):115–125. DOI: 10.1016/j.tim.2007.12.009. - 2.
Van Der Voort M, Meijer HJ, Schmidt Y, Watrous J, Dekkers E, Mendes R, Dorrestein PC, Gross H, Raaijmakers JM. Genome mining and metabolic profiling of the rhizosphere bacterium Pseudomonas sp. SH-C52 for antimicrobial compounds. Front Microbiol. 2015;6 :693. DOI: 10.3389/fmicb.2015.00693. - 3.
Singh LS, Sharma H, Talukdar NC. Production of potent antimicrobial agent by actinomycete Streptomyces sannaensis strain SU118 isolate from phoomdi in Loktak Lake of Manipur, India. BMC Microbiol. 2014;14 :278. DOI: 10.1186/s12866-014-0278-3 - 4.
Li L, Ma T, Liu Q, Huang Y, Hu C, Liao G. Improvement of daptomycin production in Streptomyces roseosporus through the acquisition of pleuromutilin resistance. BioMed Res Int. 2013;2013 :479742. DOI: 10.1155/2013/479742 - 5.
Meca G, Sospedra I, Valero MA, Mañes J, Font G, Ruiz MJ. Antibacterial activity of the enniatin B, produced by Fusarium tricictum in liquid culture, and cytotoxic effects on Caco-2 cells. Toxicol Mech Methods. 2011;21 (7):503-512. DOI: 10.3109/15376516.2011.556202 - 6.
Li Yi-M, Haddad NIA, Yang S-Z, Mu B-Z. Variants of lipopeptides produced by Bacillus licheniformis HSN221 in different medium components evaluated by a rapid method ESI-MS. Int J Pept Res Ther. 2008;14 (3):229–235. DOI: 10.1007/s10989-008-9137-0. - 7.
Wei Y-H, Chu I-M. Mn2+ improves surfactin production by Bacillus subtilis . Biotechnol Lett. 2002;24 (6):479–482. DOI: 10.1023/A:1014534021276 - 8.
Abdel-Mawgoud AM, Aboulwafa MM, Abdel-Haleem HN. Optimization of surfactin production by Bacillus subtilis isolate BS5. Appl Biochem Biotechnol. 2008;150 (3):305–325. DOI: 10.1007/s12010-008-8155-x. - 9.
Plaza G, Chojniak J, Rudnicka K, Paraszkiewicz, BP. Detection of biosurfactants in Bacillus species: genes and products identification. J Appl Microbiol. 2015;119 (4):1023–1034. DOI: 10.1111/jam.12893. - 10.
Roonsawang N, Washio K, Morikawa M. Diversity of nonribosomal peptide synthetases involved in the biosynthesis of lipopeptide biosurfactants. Int J Mol Sci. 2010; 12 (1):141–172. DOI: 10.3390/ijms12010141. - 11.
Duitman EH, Hamoen LW, Rembold M, Venema G, Seitz H, Saenger W, Bernhard F, Reinhardt R, Schmidt M, Ullrich C, Stein T, Leenders F, Vater J. The mycosubtilin synthetase of Bacillus subtilis ATCC6633: a multifunctional hybrid between a peptide synthetase, an amino transferase, and a fatty acid synthase. Proc Natl Acad Sci U S A. 1999;96 (23):13294–13299. DOI: 10.1073/pnas.96.23.13294. - 12.
Bayer AS, Schneider T, Sahl, HS. Mechanisms of daptomycin resistance in Staphylococcus aureus : role of the cell membrane and cell wall. Ann N Y Acad Sci. 2013;1277 :139–158. DOI.10.1111/j.1749-6632.2012.06819.x. - 13.
Zhang, T, Muraih JK, MacCormick B, Silverman J, Palmer M. Daptomycin forms catión-and size-selective pores in model membranes. Biochim Biophys Acta. 2014; 1838 (10):2425–2430. DOI: 10.1016/j.bbamem.2014.05.014 - 14.
Patel S, Ahmed S, Eswari SJ. Therapeutic cyclic lipopeptides mining from microbes: latest strides and hurdles. World J Microbiol Biotechnol. 2015; 31 (8):1177-1193. DOI: 10.1007/s11274-015-1880-8. - 15.
Shao C, Liu L, Gang H, Yang S, Mu B. Structural diversity of the microbial surfactin derivatives from selective esterification approach. Int J Mol Sci. 2015; 16 (1):1855–1872. DOI: 10.3390/ijms16011855.S. - 16.
Kim K, Jung SY, Lee DK, Jung JK, Park JK, Kim DK, Lee CH. Suppression of inflammatory responses by surfactin, a selective inhibitor of platelet cytosolic phospholipase A2. Biochem Pharmacol. 1998; 55 (7):975–985. DOI:10.1016/S0006-2952(97)00613-8. - 17.
Hamley IW. Lipopeptides: from self-assembly to bioactivity. Chem Commun. 2015; 51 (41):8574–8583. DOI: 10.1039/C5CC01535A. - 18.
Meena KR, Kanwar S. Lipopeptides as the antifungal and antibacterial agents: applications in food safety and therapeutics. BioMed Res Int. 2015; 2015 :473050. DOI: 10.1155/2015/473050. - 19.
Cawoy H, Mariutto M, Henry G, Fisher C, Vasilyeva N, Thonart P, Dommes J, Ongena M. Plant defense stimulation by natural isolates of Bacillus depends on efficient surfactin production. Mol Plant-Microbe Interact. 2014;27 (2):87–100. DOI: 10.1094/MPMI-09-13-0262-R. - 20.
Ali S, Hameed S, Imran A, Iqbal M, Lazarovits G. Genetic, physiological and biochemical characterization of Bacillus sp. strain RMB7 exhibiting plant growth promoting and broad spectrum antifungal activities. Microb Cell Fact. 2014;13 :144. DOI: 10.1186/s12934-014-0144-x. - 21.
Ma Z, Wang N, Hu J, Wang S. Isolation and characterization of a new iturinic lipopeptide, mojavensin a produced by a marine-derived bacterium Bacillus mojavensis . J Antibiot. 2012;65 :317–322. DOI: 10.1038/ja.2012.19. - 22.
Yin H, Guo C, Wang Y, Liu D, Lv Y, Lv F, Lu Z. Fengycins inhibits the growth of the human lung cáncer cell line 95D through reactive oxygen species production and mitochhondria-dependent apoptosis. Anti-Cancer Drugs. 2013; 24 (6):587–598. DOI: 10.1097/CAD.0b013e3283611395. - 23.
Janek T, Krasowska A, Radwanska A, Lukaszewicz M. Lipopetide biosurfactant pseudofactin II induced apoptosis of melanoma A 375 cells by specific interaction with the plasma membrane. PLoS ONE. 2013; 8 (3):e57991. DOI: 10.1371/journal.pone.0057991. - 24.
Alsohim AS, Taylor TB, Barrett GA, Gallie J, Zhang XX, Altamirano-Junqueira AE, Johnson LJ, Rainey PB, Jackson RW. The biosurfactant viscosin produced by Pseudomonas fluorescens SBW25 aids spreading motility and plant growth promotion. Environ Microbiol. 2014;16 (7):2267–2281. DOI: 10.1111/1462-2920.12469. - 25.
Gond SK, Bergen MS, Torres MS, White JF. Endophytic Bacillus spp. produce antifungal lipopeptides and induce host defence gene expression in maize. Microbiol Res. 2015;172 :79–87 DOI: 10.1016/j.micres.2014.11.004 - 26.
Mnif I, Chaabouni-Ellouze S, Ghribi D. (2012) Optimization of the nutritional parameters for enhanced production of B. subtilis SPB1 biosurfactant in submerged culture using response surface methodology. Biotechnol Res Int. 2012;2012 :795430. DOI: 10.1155/2012/795430. - 27.
Liu X, Ren B, Gao H, Liu M, Dai H, Song F, Yu Z, Wang S, Hu J, Kokare CR, Zhang L. Optimization for the production of surfactin with a new synergistic antifungal activity. PLoS One. 2012; 7 (5):e34430. DOI: 10.1371/journal.pone.0034430. - 28.
Gu X-B, Zheng Z-M, Yu H-Q, Wang J, Liang F-L, Liu R-L. Optimization of medium constituents for a novel lipopeptide production by Bacillus subtilis MO-01 by a response surface method. Process Biochem. 2005;40 :3196–3201. DOI: 10.1016/j.procbio.2005.02.011. - 29.
Singh AK, Rautela R, Cameotra SS. Substrate dependent in vitro antifungal activity ofBacillus sp strain AR2. Microb Cell Fact. 2014;13 :67. DOI: 10.1186/1475-2859-13-67. - 30.
Zhao P, Quan C, Jin L, Wang L, Wang J, Fan S. Effects of critical medium components on the production of antifungal lipopeptides from Bacillus amyloliquefaciens Q-426 exhibiting excellent biosurfactant properties. World J Microbiol Biotechnol. 2013;29 :401–409. DOI: 10.1007/s11274-012-1180-5. - 31.
Al-Ajlani MM, Sheikh MA, Ahmad Z, Hasnain S. Production of surfactin from Bacillus subtilis MZ-7 grown on pharmamedia commercial medium. Microb Cell Fact. 2007;6 :17. DOI: 10.1186/1475-2859-6-17. - 32.
Jin H, Zhang X, Li K, Niu Y, Guo M, Hu C, Wan X, Gong Y, Huang F. Direct bio-utilization of untreated rapeseed meal for effective iturin A production by Bacillus subtilis in submerged fermentation. PLoS One. 2014;9 (10):e111171. DOI: 10.1371/journal.pone.0111171. - 33.
Wei Y-H, Lai C-C, Chang J-S. Using Taguchi experimental design methods to optimize trace element composition for enhanced surfactin production by Bacillus subtilis ATCC 21332. Process Biochem. 2007;42 :40–45. DOI: 10.1016/j.procbio.2006.07.025. - 34.
Wei Y-H, Wang L-F, Chang J-S. Optimizing iron supplement strategies for enhanced surfactin production with Bacillus subtilis . Biotechnol Progr. 2004;20 :979–983. DOI: 10.1021/bp030051a. - 35.
Lin H-Y, Rao YK, Wu W-S, Tzeng Y-M. Ferrous ion enhanced lipopeptide antibiotic iturin A production from Bacillus amyloliquefaciens B128. Int J Appl Sci Eng. 2007;5 (2):123–132. - 36.
Chen W-C, Juang R-S, Wei Y-H. Applications of a lipopeptide biosurfactant, surfactin, produced by microorganisms. Biochem Eng J. 2015; 103 :158–169. DOI: 10.1016/j.bej.2015.07.009. - 37.
Fahim S, Dimitrov K, Gancel F, Vauchel P, Jacques P, Iordan Nikov I. Impact of energy supply and oxygen transfer on selective lipopeptide production by Bacillus subtilis BBG21. Bioresour Technol. 2012;126:1–6. DOI: 10.1016/j.biortech.2012.09.019. - 38.
Chtioui O, Dimitrov K, Gancel F, Dhulster P, Nikov I. Rotating discs bioreactor, a new tool for lipopeptides production. Process Biochem. 2012; 47 (12):2020–2024. DOI: 10.1016/j.procbio.2012.07.013. - 39.
Coutte F, Lecouturier D, Leclère V, Béchet M, Jacques P, Dhulster P. New integrated bioprocess for the continuous production, extraction and purification of lipopeptides produced by Bacillus subtilis in membrane bioreactor. Process Biochem. 2013;48 (1):25–32. DOI:10.1016/j.procbio.2012.10.005. - 40.
Fahim S, Dimitrov K, Vauchel P, Gancel F, Delaplace G, Jacques P, Nikova I. Oxygen transfer in three phase inverse fluidized bed bioreactor during biosurfactant production by Bacillus subtilis . Biochem Eng J. 2013;76 :70–76. DOI:10.1016/j.bej.2013.04.004. - 41.
Willenbacher J, Rau J-T, Rogalla J, Syldatk C, Hausmann R. Foam-free production of surfactin via anaerobic fermentation of Bacillus subtilis DSM 10(T). AMB Express. 2015;5 :21. DOI: 10.1186/s13568-015-0107-6. - 42.
Zhu Z, Li R, Yu G, Ran W, Shen Q. Enhancement of lipopeptides production in a two-temperature-stage process under SSF conditions and its bioprocess in the fermenter. Bioresour Technol. 2013; 127 :209–215. DOI: 10.1016/j.biortech.2012.09.119. - 43.
Zhu Z, Zhang G, Luo Y, Ran W, Shen Q. Production of lipopeptides by Bacillus amyloliquefaciens XZ-173 in solid state fermentation using soybean flour and rice straw as the substrate. Bioresour Technol. 2012;112 :254–260. DOI: 10.1016/j.biortech.2012.02.057. - 44.
Zhu Z, Zhang J, Wu Y, Ran W, Shen Q. Comparative study on the properties of lipopeptide products and expression of biosynthetic genes from Bacillus amyloliquefaciens XZ-173 in liquid fermentation and solid-state fermentation. World J Microbiol Biotechnol. 2013;29 (11):2105–2114. DOI: 10.1007/s11274-013-1375-4. - 45.
Rangarajan V, Dhanarajan G, Sen R. Improved performance of cross-flow ultrafiltration for the recovery and purification of Ca2+ conditioned lipopeptides in diafiltration mode of operation. J Membr Sci. 2014; 454 :436–443. DOI: 10.1016/j.memsci.2013.12.047. - 46.
Jauregi P, Coutte F, Catiau L, Lecouturier D, Jacques P. Micelle size characterization of lipopeptides produced by B. subtilis and their recovery by the two-step ultrafiltration process. Sep Pur Technol. 2013;104 :175–182. DOI: 10.1016/j.seppur.2012.11.017. - 47.
Mansson M, Dale EK, Hauge S, Overballe-Petersen C, Hirth KA, Hansen DB. Process for purifying lipopeptides. 2015. US Patent 9150894 B2. - 48.
Dhanarajan G, Rangarajan V, Sen R. Dual gradient macroporous resin column chromatography for concurrent separation and purification of three families of marine bacterial lipopeptides from cell free broth. Sep Pur Technol. 2015; 143 :72–79. DOI: 10.1016/j.seppur.2015.01.025. - 49.
Yang H, Li X, Li X, Yu H, Shen Z. Identification of lipopeptide isoforms by MALDI-TOF-MS/MS based on the simultaneous purification of iturin, fengycin, and surfactin by RP-HPLC. Anal Bioanal Chem. 2015; 407 :2529–2542. DOI: 10.1007/s00216-015-8486-8. - 50.
Torres MJ, Brandan CP, Petroselli G, Erra-Balsells R, Audisio MC. Antagonistic effects of Bacillus subtilis subsp.subtilis andB. amyloliquefaciens againstMacrophomina phaseolina : SEM study of fungal changes and UV-MALDI-TOF MS analysis of their bioactive compounds. Microbiol Res. 2016;182 :31–39. DOI: 10.1016/j.micres.2015.09.005. - 51.
Urajová P, Hájek J, Wahlsten M, Jokela J, Galica T, Fewer D, Kust A, Zapomelová-Kozlíková E, Delawská K, Sivonen K, Kopecký J, Hrouzek PA. Liquid chromatography-mass spectrometric method for the detection of cyclic β-amino fatty acid lipopeptides. J Chromatogr A. 2016; 1438 :76–83. DOI: 10.1016/j.chroma.2016.02.013. - 52.
Sajitha KL, Dev SA, Florence EJM. Identification and characterization of lipopeptides from Bacillus subtilis B1 against Sapstain fungus of rubberwood through MALDI-TOF-MS and RT-PCR. Curr Microbiol. 2016. DOI: 10.1007/s00284-016-1025-9. - 53.
Lopez D, Vlamankish H, Losick R, Kolter R. Cannibalism enhances biofilm development in Bacillus subtilis. Mol Microbiol. 2009; 74 :609–618. DOI: 10.1111/j.1365-2958.2009.06882.x. - 54.
Dubern JF, Lugtenberg BJJ, Bloemberg GV. The ppuI-rsaL-ppuR Quorum sensing system regulates biofilm formation of Pseudomonas putida PCL1445 by controlling biosynthesis of the cyclic lipopetides putisolvin I and II. J Bacteriol. 2006;188 :2898–2906. DOI: 10.1128/JB.188.8.2898-2906.2006. - 55.
Das P, Mukherjee S, Sen R. Genetic regulations of the biosynthesis of microbial surfactants: an overview. Biotech Genet Eng Rev. 2008; 25 :165–186 DOI: 10.5661/bger-25-165. - 56.
Schmidberger A, Henkel M, Hausmann R, Schwartz T. Expression of genes involved in rhamnolipid synthesis in Pseudomonas aeruginosa PAO1 in a bioreactor cultivation. Appl Microbiol Biotechnol. 2013;97 :5779–5791. DOI: 10.1007/s00253-013-4891-0