Classification of mitochondrial genome types based on RFLPs using coxI,
1. Introduction
Soybean is the most important crop provider of proteins and oil used in animal nutrition and for human consumption. Plant breeders continue to release improved cultivars with enhanced yield, disease resistance, and quality traits. It is also the most planted genetically modified crop. The narrow genetic base of current soybean cultivars may lack sufficient allelic diversity to counteract vulnerability to shifts in environmental variables. An investigation of genetic relatedness at a broad level may provide important information about the historical relationship among different genotypes. Such types of study are possible thanks to different markers application, based on variation of organelle DNA (mtDNA or cpDNA).
2. Mitochondrial genome
2.1. Genomes as markers
Typically, all sufficiently variable DNA regions can be used in genetic studies of populations and in interspecific studies. Because of in seed plants chloroplasts and mitochondria are mainly inherited uniparentally, organelle genomes are often used because they carry more information than nuclear markers, which are inherited biparentally. The main benefit is that there is only one allele per cell and per organism, and, consequently, no recombination between two alleles can occur. With different dispersal distances, genomes inherited biparentally, maternally and paternally, also reveal significant differences in their genetic variability among populations. In particular, maternally inherited markers show diversity within a population much better [1].
In gymnosperms the situation is somewhat different. Here, chloroplasts are inherited mainly paternally and are therefore transmitted through pollen and seeds, whereas mitochondria are largely inherited maternally and are therefore transmitted only by seeds [2]. Since pollen is distributed at far greater distances than seeds [3], mitochondrial markers show a greater population diversity than chloroplast markers and therefore serve as important tools in conducting genetic studies of gymnosperms [4]. Mitochondrial markers are also sometimes used in conjunction with cpDNA markers [5].
Mitochondrial regions used in interspecific studies of plants, mainly gymnosperms, include, for example, introns of the NADH dehydrogenase gene
In addition to the aforementioned organelle markers, microsatellite markers [10, 11] and simple sequence repeats (SSR) are often used in population biology, and sometimes also in phylogeographic studies. Microsatellites are much less common in plants than in animals [12]. However, they are present in both the nuclear genome and the organelle genome. Microsatellites may reveal a high variability, which may be useful in genetic studies of populations, whereas other sequences or methods such as fingerprinting do not detect mutations sufficiently [9,10,13]. Inherited only uniparentally, organelle markers have a certain quality in phylogeographic analyses. Since they are haploid, the effective population size should be reduced after the analysis using these markers as compared to those in which nuclear markers are used [1, 14]. Smaller effective populations sizes should bring about faster turnover rates for newly evolving genotypes, resulting in a clearer picture of past migration history than those obtained using nuclear markers [15-17].
Initially, it was mainly in phylogeographic studies of animal species that mitochondrial markers were used [18]. These studies have provided some interesting data on the beginnings and the evolutionary history of human population [19]. In contrast to studies of animals, using mitochondrial markers in studies of plants, especially angiosperms, is limited [20]. Presently, cpDNA markers are most commonly used in phylogeographic studies of angiosperms, whereas mitochondrial markers are prevalent in studies of gymnosperms.
2.2. Plant mitochondrial DNA
Mitochondrial genomes of higher plants (208-2000 kbp) are much larger than those of vertebrates (16-17 kbp) or fungi (25-80 kbp) [21, 22]. In addition, there are clear differences in size and organization of mitochondrial genomes between different species of plants. Intramolecular recombination in mitochondria leads to complex reorganizations of genomes, and, in consequence, to alternating arrangement of genes, even in individual plants, and the occurrence of duplications and deletions are common [23]. In addition, the nucleotide substitution rate in plant mitochondria is rather low [24], causing only minor differences within certain loci between individuals or even species. Extensively characterized circular animal mitochondrial genomes are highly conservative within a given species; they do not contain introns and have a very limited number of intergenic sequences [25]. Plant mitochondrial DNA (mtDNA) contains introns in multiple genes and several additional genes undergoing expression when compared to animal mitochondria, but most of the additional sequences in plants are not expressed and they do not seem to be esssentials [26]. The completely sequenced mitochondrial genomes are available for several higher plants, including
Restriction maps of nearly all plant mitochondrial genomes provide for the occurrence of the master circle with circular subgenomic molecules that arise after recombination among large direct repeats (> 1 kbp) [21, 29-36], which are present in most mitochondrial genomes of higher plants. However, such molecules, whose sizes can be predicted, are very rare or very difficult to observe. It can be explained by the fact that plant mitochondrial genomes are circularly permuted as in the phage T4 [37, 38]. Oldenburg and Bendich reported that mostly linear molecules in
Many reports that have appeared in recent years indicate that mitochondrial genome of yeasts and of higher plants exist mainly as linear and branched DNA molecules with variable size which is much smaller than the predicted size of the genomes [39-44]. Using pulsed field gel electrophoresis (PFGE) of in-gel lysed mitochondria from different species revealed that only about 6-12% of the molecules are circular [41, 44]. The observed branched molecules are very similar to the molecules seen in yeast in the intermediate stages of recombination of mtDNA [45] or the phage T4 DNA replication [37, 38].
In all but one known case (
Maternally inherited mutations, which are associated with mitochondria in higher plants, most often occur as a result of intra- and intergenic recombination. This happens in most cases of cytoplasmic male sterility (cms) [41, 49-51], in
2.3. Mitochondrial genome of soybean
The size of soybean mtDNA has been estimated to be approximately 400 kb [54-56]. Spherical molecules have also been observed by electron microscopy [55, 57].
Repeated sequences 9, 23 and 299 bp have been characterized in soybean mitochondria [58, 59]. Also, numerous reorganizations of genome sequences have been characterized among different cultivars of soybean. It has been demonstrated that they occur through homologous recombination produced by these repeat sequences [58, 60, 61], or through short elements that are part of 4.9kb PstI fragment of soybean mtDNA [62]. The 299 bp repeat sequence has been found in several copies of mtDNA of soybean and in several other higher plants, suggesting that this repeated sequence may represent a hot spot for recombination of mtDNA in many plant species [59, 62]. Previous results suggested that active homologous recombinations of mtDNA are present in at least some species of plants. Recently (2007) amitochondrial-targeted homolog of the
The repeated sequences of the
The first data for the restriction map of soybean mtDNA were obtained from the analysis of loci of the
In the mitochondrial genome of cultivar Williams 82, recombinantly active repeats 1 kb and 2 kb have been described [48]. In a different repeat of 10 kb, surrounding both 1 kb and 2 kb repeats, two breakpoints have been identified. This recombination of smaller and larger repeats probably leads to the complex structure of genomes.
The analysis of restriction fragment length polymorphism (RFLP) of mtDNA seems to be a useful method in studying phylogenetic relationships within species.
Grabau et al. (1992) analyzed the genomes of 138 soybean cultivars [60]. Using 2.3 kb HindIII mtDNA probe from Williams 82 soybean cultivar revealed restriction fragment length polymorphisms (RFLPs), which allowed for the division of many soybean cultivars into four cytoplasmic groups: Bedford, Arksoy, Lincoln and soja-forage.
Subsequent analyses showed variations within, and adjacent to, the 4.8 kb repeats. Bedford cytoplasm turned out to be the only one that contains copies of the repeat in four different genomic environments, which indicates its recombination activity [61]. Lincoln and Arksoy cytoplasms contain two copies of the repeat and a unique fragment that appear to result from rare recombination events outside, but near, the repeat. In contrast, forage-soja cytoplasm contains no complete repeat, but it contains a unique truncated version of the repeat [61]. Sequence analysis revealed that truncating is caused by the recombination with a repeat of 9 bp CCCCTCCCC. The structural reorganization that occurred in the region around 4.8 kb repeat may provide a way to analyze the relationships between species and evolution within the soybean subgenus.
In order to determine the sources of cytoplasmic variability, Hanlon and Grabau (1995) studied the old cultivars of soybeans with the same 2.3-kb
Mt type | Probe |
|
|
|
Reference | |||||
---|---|---|---|---|---|---|---|---|---|---|
Enzyme |
|
|
|
|
|
|
|
|
||
Ic | 1,6 | 5,8 | 5,0 | [69] | ||||||
Id | 1,6 | 5,8 | 5,0;6,0 ;12,0 | [69] | ||||||
Ie | 1,6 | 5,8 | 5,0; 12,0 | [69] | ||||||
Ik | 1,6 | 5,8 | 5,0; 5,4; 5,8 | [69] | ||||||
IIg | 1,3 | 7,0 | 1,0; 2,6 | [69] | ||||||
IIIa | 1,2 | 8,5 | 2,4; 5,0 | [69] | ||||||
IIIb | 1,2 | 8,5 | 2,9; 5,0 | [69] | ||||||
IIId | 1,2 | 8,5 | 5,0;6,0; 12,0 | [69] | ||||||
IVa | 3,5 | 8,1 | 2,4; 5,0 | [69] | ||||||
IVb | 3,5 | 8,1 | 2,9; 5,0 | [69] | ||||||
IVc | 3,5 | 8,1 | 5,0 | [69] | ||||||
IVf | 3,5 | 8,1 | 2,4; 3,5; 5,0 | [69] | ||||||
IVh | 3,5 | 8,1 | 2,6; 2,9 | [69] | ||||||
IVi | 3,5 | 8,1 | 5,2; 12,0 | [69] | ||||||
Va | 5,8 | 8,1 | 2,4; 5,0 | [69] | ||||||
V’j | 5,8 | 15,0 | 5,0; 6,0 | [69] | ||||||
VIg | 1,7 | 5,8 | 1,0; 2,6 | [69] | ||||||
VIIg | 8,5 | 15,0 | 1,0; 2,6 | [69] | ||||||
mtI | 1,6 | 5,8 | [69] | |||||||
mtII | 1,3 | 7,0 | [69] | |||||||
mtIII | 1,2 | 8,1 | [69] | |||||||
mtIV | 3,5 | [69] | ||||||||
mtV | 5,8 | [69] | ||||||||
mt-a | 2,4; 5,0 | [87] | ||||||||
mt-b | 2,9; 5,0 | [87] | ||||||||
mt-c | 5,0 | [87] | ||||||||
mt-d | 5,0; 6,0; 12,0 | [87] | ||||||||
mt-e | 5,0; 12,0 | [87] | ||||||||
mt-f | 2,4; 3,5; 5,0 | [87] | ||||||||
mt-g | 1,0; 2,6 | [87] | ||||||||
mt-h | 2,6; 2,9 | [87] | ||||||||
mt-m | 2,9 | [87] | ||||||||
mt-n | 12,0 | [87] | ||||||||
Ic | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 1,6 | 5,8 | 1,9 | 5,0 | 8,2; 12,0 | [58] | |
Id | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 1,6 | 5,8 | 1,9 | 5,0; 6,0; 12,0 | 2,8; 6,0; 12,0 | [58] | |
Ie | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 1,6 | 5,8 | 1,9 | 5,0; 12,0 | 2,8; 6,0; 12,0 | [58] | |
Ik | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 1,6 | 5,8 | 1,9 | 5,0; 5,4; 5,8 | 2,8; 6,0; 12,0 | [58] | |
IIg | 8,5 | 0,8; 2,5; 5,0 | 9,0 | 1,3 | 7,0 | 4,8 | 1,0; 2,6 | 2,8; 3,0; 9,5 | [58] | |
IIIb | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 1,2 | 8,5 | 6,2; 6,5 | 2,9; 5,0 | 6,0; 8,2; 12,0 | [58] | |
IIId | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 1,2 | 8,5 | 6,2; 6,5 | 5,0; 6,0; 12,0 | 3,2; 6,2; 12,0 | [58] | |
Iva | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 3,5 | 8,1 | 5,0 | 2,4; 5,0 | 3,0; 6,0; 12,0 | [58] | |
IVb | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 3,5 | 5,8 | 5,0 | 2,9; 5,0 | 6,0; 8,2; 12,0 | [58] | |
IVc | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 3,5 | 5,8 | 5,0 | 5,0 | 8,2; 12,0 | [58] | |
IVf | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 3,5 | 5,8 | 5,0 | 2,4; 3,5; 5,0 | 3,2; 6,2; 12,0 | [58] | |
IVh | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 3,5 | 5,8 | 5,0 | 2,6; 2,9 | 3,2; 6,2; 12,0 | [58] | |
IVi | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 3,5 | 5,8 | 5,0 | 5,2; 12,0 | 3,2; 6,2; 12,0 | [58] | |
Va | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 5,8 | 5,8 | 12,0 | 2,4; 5,0 | 3,0; 6,0; 12,0 | [58] | |
Vb | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 5,8 | 5,8 | 12,0 | 2,9; 5,0 | 6,0; 8,2; 12,0 | [58] | |
Vc | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 5,8 | 5,8 | 12,0 | 5,0 | 8,2; 12,0 | [58] | |
V’j | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 5,8 | 15,0 | 1,6 | 5,0; 6,0 | 2,8; 6,0; 12,0 | [58] | |
VIg | 5,6; 8,5 | 0,8; 2,5; 5,0; 5,2 | 9,0; 10,5 | 1,7 | 5,8 | 4,5 | 1,0; 2,6 | 2,8; 3,0; 4,3; 9,5; 12,0 | [58] | |
VIIg | 8,5 | 0,8; 5,0; 5,2 | 9,0 | 8,5 | 15,0 | 1,6 | 1,0; 2,6 | 2,8; 3,0; 9,5 | [58] | |
VIIIc | 5,6 | 0,8; 2,5; 5,0 | 10,5 | 8,5; 10,0 | 11,0; 15,0 | 1,6 | 5,0 | 8,2; 12,0 | [58] | |
|
||||||||||
cpI+mtIIIb | 1,2 | 8,5 | 2,9; 5,0 | [89] | ||||||
cpI+mtIVb | 3,5 | 8,1 | 2,9; 5,0 | [89] | ||||||
cpI+mtIVc | 3,5 | 8,1 | 5,0 | [89] | ||||||
cpII+mtIVb | 3,5 | 8,1 | 2,9; 5,0 | [89] | ||||||
cpII+mtIVc | 3,5 | 8,1 | 5,0 | [89] | ||||||
cpIII+mtIe | 1,6 | 5,8 | 5,0; 12,0 | [89] | ||||||
cpIII+mtIVa | 3,5 | 8,1 | 2,4; 5,0 | [89] | ||||||
cpIII+mtVIIIc | 8,5; 10,0 | 11,0; 15,0 | 5,0 | [89] |
In their research Tozuka et al. (1998) used two fragments of mtDNA as probes: the 0.7-kb
Based on the RFLPs detected in gel-blot analysis with the
Kanazawa et al. (1998) gathered 1097
The mitochondrial
The open reading frame shares 79% of nucleotide identity with the
So for a total of 26 mtDNA haplotypes of wild soybeans have been identified based on RFLP with probes from two mitochondrial genes:
3. Chloroplast genome
As the result of the extensive research conducted in the past two decades, cpDNA analysis brought about fundamental changes to the systematics of plants. The chloroplast genome is ideal for phylogenetic analyses of plants for several reasons. First, it occurs abundantly in plant cells and is taxonomically ubiquitous. And since it is well researched, it can be easily tested in the laboratory conditions and analyzed in comparative programs. Moreover, it often contains marker structural features cladistically useful, and, above all, it exhibits moderate or low rate of nucleotide substitution [89]. In regard to the mitochondrial genome, and also to cpDNA, researchers use in their studies two distinct phylogenetic approaches [90], namely taxonomic checking of specific traits features of molecular cpDNA and sequencing of specific genes or regions.
3.1. Chloroplast genome of soybean
In estimating the phylogeny of plants belonging to
The summary phylogeny was based on sequence of several cpDNA genes from hundreds of spermatophytes including
|
|
|
|
|
Ribulose -1,5- bisphosphate carboxylase, large subunit |
|
Photosystem I, P700 apoproteins A1, A2 |
|
9kDa protein |
|
Photosystem II, D1 protein |
|
47kDa chlorophyll a-binding protein |
|
43 kDa chlorophyll a-binding protein |
|
D2 protein |
|
Cytochrome b559 (8kDa protein) |
|
Cytochrome b559 (4kDa protein) |
|
10 kDa phosphoprotein |
|
–J, -K, -L, -M, -N-proteins |
|
H+ -ATPase, CF1 subunits α, β, ε |
|
CF0 subunits I, III, IV |
|
Cytochrome b6
|
|
NADH Dehydrogenase, subunits ND 1, NDI 1 |
|
|
|
16S rRNA |
|
23S rRNA |
|
Alanine tRNA (UGC) |
|
Gliycine tRNA (UCC) |
|
Histidine tRNA (GUG) |
|
Isoleucine tRNA (GAU) |
|
Lysine tRNA (UUU) |
|
Leucine tRNA ( UAA) |
|
30S: ribosomal proteins CS2, CS7, CS12, CS16 |
|
50S: ribosomal proteins CL2, CL 20, CL32 |
|
RNA polymerase, subunits α, β, β’, β’’ |
|
Maturase –like protein |
|
Small plastid RNA |
|
|
|
ATP-dependent protease, proteolytic subunit |
|
Intron- containing Reading frame ( 168 codons) |
The complete size of the
In comparison with other eukaryotic genomes, cpDNA is highly concentrated, for example, only 32% of the rice genome is non-coding. In
3.2. Extent of IR in Glycine
Analysis of the IR (inverted repeats) regions in
Introns or intergenic sequences in legume chloroplast DNA have become extremely important tools in phylogenetic analyses aimed at systematizing of this species [110, 111]. Moreover, their microstructural changes occur with great frequency in the regions of cpDNA. The body of existing research suggests that mutations in the non-coding regions and relatively fast evolution of the organelle genome encoding regions can serve as valuable markers for the separation species in their evolutionary origin [110, 111]. The systematics of plants generally considers chloroplast indeles to be phylogenetic markers, because of their low prevalence in comparison with nucleotide substitutions [5].
3.3. CpDNA markers
There are many methods of generating molecular markers that rely on site-specific amplification of a selected DNA fragment using polymerase chain reaction (PCR) and its further processing (restriction analysis, sequencing). Initially the research on the plant genome (mostly phylogenetic studies) used non-coding and coding sequences of chloroplast DNA. With time, the genes or DNA segments located in the nuclear DNA, mitochondrial (mtDNA) and chloroplast (cpDNA) found a prominent place among plant DNA markers. Fully automated DNA sequencing made it possible to subject ever-newer regions of plant DNA to comparative sequencing.
One of the most frequently sequenced cpDNA fragments in plant phylogeny of spermatophytes is the
It should be noted that the rate of evolution for a specific DNA region to be used as a marker can vary significantly not only among systematic groups, but also within these groups [98]. Moreover, each DNA fragment within the same group has a different rate of evolution, such as the
3.4. The genetic diversity of soybeans
The importance of genetic variations in facilitating plant breeding and/or conservation strategies has long been recognized [121]. Molecular markers are useful tools for assaying genetic variation and provide an efficient means to link phenotypic and genotypic variation [122]. In recent years, the progress made in the development of DNA based marker systems has advanced our understanding of genetic resources. These molecular markers are classified as: (i) hybridization based markers i.e. restriction fragment length polymorphisms (RFLPs), (ii) PCR-based markers i.e. random amplification of polymorphic DNAs (RAPDs), amplified fragmentlength polymorphisms (AFLPs), inter simple sequence repeats (ISSRs) and microsatellites or simple sequence repeats (SSRs), and (iii) sequence based markers i.e. single nucleotide polymorphisms (SNPs) [121, 123]. Majority of these molecular markers have been developed either from genomic DNA library (e.g. RFLPs or SSRs) or from random PCR amplification of genomic DNA (e.g. RAPDs) or both (e.g. AFLPs) [123]. Availability of an array of molecular marker techniques and their modifications led to comparative studies among them in many crops including soybean, wheat and barley [124-126]. Among all these, SSR markers have gained considerable importance in plant genetics and breeding owing to many desirable attributes including hypervariability, multiallelic nature, codominant inheritance, reproducibility, relative abundance, extensive genome coverage (including organellar genomes), chromosome specific location, amenability to automation and high throughput genotyping [127]. In contrast, RAPD assays are not sufficiently reproducible whereas RFLPs are not readily adaptable to high throughput sampling. AFLP is complicated as individual bands are often composed of multiple fragments mainly in large genome templates [123]. The general features of DNA markers are presented in Table 3.
|
||||
|
|
|
|
|
|
Essential | Essential | Not required | Not required |
|
Low | High | Low | Low-moderate |
|
Co-dominant | Co-dominant | Co-dominant | Co-dominant |
|
High | Low-moderate | Moderate-high | Low-moderate |
|
High | High | Moderate | Low-moderate |
|
Low | High | High | Low-moderate |
The genetic diversity of wild and cultivated soybeans has been studied by various techniques including isozymes [128], RFLP [87], SSR markers [124], and cytoplasmic DNA markers [87, 128, 129]. Based on haplotype analysis of chloroplast DNA, cultivated soybean appears to have multiple origins from different wild soybean populations [129, 130].
Using PCR-RFLP method soybean chloroplast DNAs were classified into three main haplotype groups (I, II and III) [113, 130, 131]. Type I is mainly found in the species of cultivated soybean (
Analyses of non-coding regions of cpDNA have been employed to elucidate phylogenetic relationship of different taxa [90]. Compared with coding regions, non-coding regions may provide more informative characters in phylogenetic studies at the species level because of their high variability due to the lack of functional constraints. Non-coding regions of cpDNA have been assayed either by direct sequencing [136-141], or by restriction-site analysis of PCR products (PCR-RFLP) [142-146]. In Small's opinion (1998) non-coding regions, which include introns and intergenic sequences, often show greater variability at nucleotides than at the encoding regions, which makes the non-coding regions good phylogenetic markers [139]. Mutations in the form of insertions and deletions are accumulated in noncoding regions at the same rate as nucleotide substitutions, and such kinds of mutations significantly accelerate changes in these regions. In many cases, insertions or deletions are related to short repeat sequences. Therefore, many researchers continually focus on the analysis of non-coding regions. Using RFLP method, Close et al. (1989) found six cpDNA haplotypes and described them in types, ranging from group I to VI, including cultivated and wild soybeans [147]. In the course of their research they found that groups I and II diverge from groups III to VI, thus dividing subgenus
3.5. Non-coding regions of the chloroplast genome as site-specific markers in Glycine
In the chloroplast genomes of legumes, including soybean, there are many non-coding regions, which are characterized by a faster rate of evolution when compared to the coding regions. As mentioned earlier some of the chloroplast genes have introns, yet their structure differs from those occuring in the nuclear genes, since in the case of cpDNA introns have a tendency to adopt secondary structure, which affects the model in which cpDNA introns evolve and it is enforeced by the secondary structure. This restriction in changes caused by mutations affects the functional requirements related to the formation of introns [98, 108]. As there are no adequate studies on the evolution of introns, it can be assumed that their evolution is similar to that of the protein-encoding genes. The loss of introns in the course of the evolution of chloroplast DNA is an interesting process. It has been discovered that
Non-coding regions in chloroplast DNA have become a major source for phylogenetic studies within the species
As the result, many studies on phylogenetic utility of non-coding regions have been published [110]. For example [150]:
In cpDNA analysis of many plants, very conservative regions flanking areas with high variability are used. The more conservative regions, the higher the chance for the primers designed in the PCR reaction, which will be able to join the broader taxonomic group [96, 113]. The region occurring between the
|
|
Annealing temperature |
|
|
f:TGATCCACTTGGCTACATCCGCC r: GCTAACCTTGGTATGGAAGT |
60°C | [99] (tobacco) [150] (soybean) |
|
f: GATTAGCAATCCGCCGCTTT r: TTACCACTAAACTATACCCGC |
60°C | [99] (tobacco) [99] (tobacco) |
|
f: GGATTCGAACCGATGACCAT r: TTAAGTCCGTAGCGTCTACC |
60°C | [113] (soybean) [99] (tobacco) |
|
f: TCGTGAGGGTTCAAGTCC r: AGATTTGAACTGGTGACACG |
56°C | [99] (tobacco) [99] (tobacco) |
|
f: GAAGTAGTAGGATTGATTCTC r: CAACACTTGCTTTAGTCTCTG |
58°C | [99] (tobacco) [99] (tobacco) |
|
f: AGATGTTTTTGCTGGTATTGA r: TTCAACAGTTTGTGTAGCCA |
56°C | [99] (tobacco) [99] (tobacco) |
|
f:GTATGGATATATCCATTTCGTG r: TGAATAACTTACCCATGAATC |
50°C | [148] (soybean) [148] (soybean) |
|
f: ACTGAACAGGCGGGTACA r: ATCCGAAGCGATGCGTTG |
50°C | [148] (soybean) [148] (soybean) |
|
f: GAAAATTAAGGAACCCGCAA r: TCAACTCGTATCAACCAATC |
56°C | [99] (tobacco) [99] (tobacco) |
In most studied species, the
Thus, in angiosperms, using non-coding regions in research at lower levels of the genome is a routine practice [108]. A large number of non-coding regions of cpDNA has been located in angiosperms, some of which are highly variable, whereas others show relatively small variability [108]. In studying the chloroplast genome, many researchers looked for universal primers that would allow amplification of many non-coding regions of cpDNA (Table 4) [111, 113, 148, 150].
4. Conclusion
In phylogenetic and population studies of
References
- 1.
Petit R. J. Duminil J. Fineschi S. Hampe A. Salvini D. Vendramin G. G. 2005 Comparative organization of chloroplast, mitochondrial and nuclear diversity in plant populations 14 689 701 - 2.
Wagner D. B. 1992 Nuclear, chloroplast, and mitochondrial DNA polymorphisms as biochemical markers in population genetic analyses of forest trees 6 373 390 - 3.
Liepelt S. Bialozyt R. Ziegenhagen B. 2002 Wind-dispersed pollen mediates postglacial gene flow among refugia USA 99 14590 14594 - 4.
Johansen A. D. Latta R. G. 2003 Mitochondrial haplotype distribution, seed dispersal and patterns of postglacial expansion of ponderosa pine 12 293 298 - 5.
Chiang Y. C. Hung K. H. Schaal B. A. Ge X. J. Hsu T. W. Chiang T. Y. 2006 Contrasting phylogeographical patterns between mainland and island taxa of the Pinus luchuensis complex 15 765 779 - 6.
Jaramillo-Correa J. P. Beaulieu J. Bousquet J. 2004 Variation in mitochondrial DNA reveals multiple distant glacial refugia in black spruce (Picea mariana), a transcontinental North American conifer 13 2735 2747 - 7.
Godbout J. Jaramillo J. P. Beaulieu J. Bousquet J. 2005 A mitochondrial DNA minisatellite reveals the postglacial history of jack pine (Pinus banksiana), a broad-range North American conifer 14 3497 3512 - 8.
Huang S. Chiang Y. C. Schaal B. A. Chou C. H. Chiang T. Y. 2001 Organelle DNA phylogeography of Cycas taitungensis, a relict species in Taiwan 10 2669 2681 - 9.
Pleines T. Jakob S. S. Blattner D. B. 2009 Application of non-coding DNA regions in intraspecific analyses 282 281 294 - 10.
Tautz D. 1989 Hypervariability of simple sequences as a general source for polymorphic DNA markers 17 6463 6471 - 11.
Tautz D. Trick M. Dover G. A. 1986 Cryptic simplicity in DNA is a major source of genetic variation 322 652 656 - 12.
Lagercrantz U. Ellegren H. Andersson L. 1993 The abundance of various polymorphic microsatellite motifs differs between plants and vertebrates 21 1111 1115 - 13.
Powell W. Morgante M. Mc Devitt R. Vendramin G. G. Rafalski J. A. 1995 Polymorphic simple sequence repeat regions in chloroplast genomes: applications to the population genetics of pines USA 92 7759 77763 - 14.
Birky C. W. Fuerst P. Maruyama T. 1989 Organelle gene diversity under migration, mutation, and drift: equilibrium expectations, approach to equilibrium, effects of heteroplasmic cells, and comparison to nuclear genes 121 613 627 - 15.
Rendell S. Ennos R. A. 2002 Chloroplast DNA diversity in Calluna vulgaris (heather) populations in Europe 11 69 78 - 16.
Hudson R. R. Coyne J. A. 2002 Mathematical consequences of the genealogical species concept 56 1557 1565 - 17.
Kadereit J. W. Arafeh R. Somogyi G. Westberg E. 2005 Terrestrial growth and marine dispersal? Comparative phylogeography of five coastal plant species at a European scale 54 861 876 - 18.
Avise J. C. 2000 Cambridge Harvard University Press - 19.
Richards M. B. Macauly V. A. Bandelt H. J. Sykes B. C. 1998 Phylogeography of mitochondrial DNA in western Europe 62 241 260 - 20.
Tomaru N. Takahashi M. Tsumura Y. Takahashi M. Ohba K. 1998 Intraspecific variation and phylogeographic patterns of Fagus crenata (Fagaceae) mitochondrial DNA 85 629 636 - 21.
Mackenzie S. Mc Intosh L. 1999 Higher plant mitochondria 11 571 585 - 22.
Schuster W. Brennicke A. 1994 The plant mitochondrial genome: physical structure, information content, RNA editing, and gene migration to the nucleus 45 61 78 - 23.
Palmer J. D. 1992 Mitochondrial DNA in plant systematics: applicationsand limitations New York Chapman and Hall 26 49 - 24.
Wolfe K. H. Li W. H. Sharp P. M. 1987 Rates of nucleotide substitution vary greatly among plant mitochondrial, chloroplast, and nuclear DNAs USA 84 9054 9058 - 25.
Larsson N. G. Clayton D. A. 1995 Molecular genetic aspects of human mitochondrial disease 29 151 178 - 26.
Binder S. Marchfelder A. Brennicke A. 1996 Regulation of gene expression in plant mitochondria 32 303 314 - 27.
Unseld M. Marienfeld J. Brandt P. Brennicke A. 1997 The mitochondrial genome of Arabidopsis thaliana contains 57 genes in 366,924 nucleotides 15 57 61 - 28.
Oda K. Yamato K. Ohata E. Nakamura Y. Takemura M. Nozato N. Akashi K. Kanrgae T. Ogura Y. Kohchi T. Ohyama K. 1992 Gene organization from the complete sequence of liverwort, Marchantia polymorpha, mitochondrial DNA: a primitive form of plant mitochondrial genome 223 1 7 - 29.
Backert S. Nielsen B. L. Borner T. 1997 The mystery of the rings: structure and replication of mitochondrial genomes from higher plants 2 477 483 - 30.
Andre C. P. Walbot V. 1995 Pulsed-field gel mapping of maize mitochondrial chromosomes 247 255 263 - 31.
Bendich A. J. 1993 Reaching for the ring: the study of mitochondrial genome structure 24 279 290 - 32.
Fauron C. Casper M. Gao Y. Moore B. 1995 The maize mitochondrial genome: dynamic, yet functional 11 228 235 - 33.
Fauron C. M. R. Casper M. Gesteland R. Albertsen M. 1992 A multi-recombination model for the mtDNA rearrangements seen in maize cmsT regenerated plants 2 949 958 - 34.
Palmer J. D. Herbon L. A. 1988 Plant mitochondrial DNA evolves rapidly in structure, but slowly in sequence 28 87 97 - 35.
Palmer J. D. Shields C. R. 1984 Tripartite structure of the Brassica campestris mitochondrial genome 307 437 440 - 36.
Palmer J. D. Makaroff C. A. Apel I. J. Shirzadegan M. 1990 Fluid structure of plant mitochondrial genomes: evolutionary and functional implications New York Alan R. Liss 85 96 - 37.
Mosig G. 1987 The essential role of recombination in phage T4 growth 21 347 371 - 38.
Mosig G. 1998 Recombination and recombinationdependent DNA replication in bacteriophage T4 32 379 413 - 39.
Oldenburg D. J. Bendich A. J. 2001 Mitochondrial DNA from the liverwort Marchantia polymorpha: circularly permuted linear molecules, head-to-tail concatemers, and a 50 protein 310 549 562 - 40.
Backert S. Dorfel P. Borner T. 1995 Investigation of plant organellar DNA by pulsed-field gel electrophoresis 28 390 399 - 41.
Backert S. Lurz R. Oyarzabal O. A. Borner T. 1997 High content, size and distribution of singlestranded DNA in the mitochondria of Chenopodium album (L.) 33 1037 1050 - 42.
Bendich A. J. Smith S. B. 1990 Moving pictures and pulsed-field gel electrophoresis show linear DNA molecules from chloroplasts and mitochondria 17 421 425 - 43.
Bendich A.J. 1996 Structural analysis of mitochondrial DNA molecules from fungi and plants using moving pictures and pulsed-field gel electrophoresis 225 564 588 - 44.
Oldenburg D. J. Bendich A. J. 1996 Size and structure of replicating mitochondrial DNA in cultured tobacco cells 8 447 461 - 45.
Sena E. P. Revet B. Moustacchi E. 1986 In vivo homologous recombination intermediates of yeast mitochondrial DNA analyzed by electron microscopy 202 421 428 - 46.
Palmer J. D. Herbon L. A. 1987 Unicircular structure of the Brassica hirta mitochondrial genome 11 565 570 - 47.
Stern D. B. Palmer J. D. 1984 Recombination sequences in plant mitochondrial genomes: Diversity and homologies to known mitochondrial genes 12 6141 6157 - 48.
Chanut F. A. Grabau E. A. Gesteland R. F. 1993 Complex organization of the soybean mitochondrial genome: recombination repeats and multiple transcripts at the atpA loci 23 234 247 - 49.
Dewey R. E. Levings C. S. III. Timothy D. H. 1986 Novel recom- binations in the maize mitochondrial genome produce a unique transcriptional unit in the Texas male-sterile cytoplasm 44 439 439 - 50.
Laver H. K. Reynolds S. J. Moneger F. Leaver C. J. 1991 Mitochondrial genome organization and expression associated with cytoplasmic male sterility in sunflower (Helianthus annuus) 1 185 193 - 51.
Johns C. Lu M. Lyznik A. Mackenzie S. 1994 A mitochondrial DNA sequence is associated with abnormal pollen development in cytoplasmic male sterile bean plants 4 435 449 - 52.
Martinez-Zapater J. M. Gil P. Capel J. Somerville C. R. 1992 Mutations at the Arabidopsis CHM locus promote rearrangements of the mitochondrial genome 4 889 899 - 53.
Newton K. Knudsen C. Gabay-Laughnan S. Laughnan J. 1990 An abnormal growth mutant in maize has a defective mitochondrial cytochrome oxidase gene 2 107 113 - 54.
Levings C. S. III. Pring D. R. 1979 Mitochondrial DNA of higher plants and genetic engineering. In: Setlow JK, Hollaender A (ed.) 1 New York Plenum Press 205 222 - 55.
Bailey-Serres J. Leroy P. Jones S. S. Wahleithner J. A. Wolstenholme D. R. 1987 Size distribution of circular molecules in plant mitochondrial DNAs 12 49 53 - 56.
Grabau E. Davis W. H. Gengenbach B. G. 1989 Restriction fragment length polymorphism in a subclass of the mandarin soybean 29 1554 1559 - 57.
Synenki R. M. Levings C. S. III. Shah D. M. 1978 Physicochemical characterization of mitochondrial DNA from soybean 61 460 464 - 58.
Kanazawa A. Tozuka A. Kato S. Mikami T. Abe J. Shimamoto Y. 1998 Small interspersed sequences that serve as recombination sites at the cox2 and atp6 loci in the mitochondrial genome of soybean are widely distributed in higher plants 33 188 198 - 59.
Kato S. Kanazawa A. Mikami T. Shimamoto Y. 1998 Evolutionary changes in the structures of the cox2 and atp6 loci in the mitochondrial genome of soybean involving recombination across small interspersed sequences 34 303 312 - 60.
Grabau E. A. Davis W. H. Phelps N. D. Gengenbach B. G. 1992 Classification of soybean cultivars based on mitochondrial DNA restriction fragment length polymorphisms 32 271 274 - 61.
Moeykens C. A. Mackenzie S. A. Shoemaker R. C. 1995 Mitochondrial genome diversity in soybean: repeats and rearrangements 29 245 254 - 62.
Hanlon R. W. Grabau E. A. 1997 Comparison of mitochondrial organization of four soybean cytoplasmic types by restriction mapping 24 208 210 - 63.
Khazi F. R. Edmondson A. C. Nielsen B. L. 2003 An Arabidopsis homologue of bacterial RecA that complements an E. coli recA deletion is targeted to plant mitochondria 269 454 463 - 64.
Manchekar M. Scissum-Gunn K. Song D. Khazi F. Mc Lean S. L. Nielsen B. L. 2006 DNA Recombination Activity in Soybean Mitochondria 356 288 299 - 65.
Grabau E. A. Havlik M. Gesteland R. F. 1988 Chimeric Organization of Two Genes for the Soybean Mitochondrial Atpase Subunit 6 13 83 89 - 66.
Wissinger B. Brennicke A. Schuster W. 1992 Regenerating good sense: RNA editing and trans-splicing in plant mitochondria 8 322 328 - 67.
Hanlon R. Grabau E. A. 1995 Cytoplasmic diversity in old domestic varieties of soybean using two mitochondrial markers 35 1148 1151 - 68.
Grabau E. A. Davis W. H. 1992 Cytoplasmic diversity in Glycine soja 19 140 144 - 69.
Tozuka A. Fukushi H. Hirata T. Ohara M. Kanazawa A. Mikami T. Abe J. Shimamoto Y. 1998 Composite and clinal distribution of Glycine soja in Japan revealed by RFLP analysis of mitochondrial 96 170 176 - 70.
Schuster W. Brennicke A. 1987 Nucleotide sequence of the Oenothera ATPase subunit 6 gene 15 9092 . - 71.
Braun C. J. Levings C. S. III. 1985 Nucleotide Sequence of the F(1)-ATPase alpha Subunit Gene from Maize Mitochondria 79 2 571 577 - 72.
Isaac G. I. Brennicke A. Dunbar M. Leaver C. J. 1985 The mitochondrial genome of fertile maize (Zea mays L.) contains two copies of the gene encoding the alpha-subunit of the F1-ATPase 10 4 321 328 - 73.
Schuster W. Brennicke A. 1986 Pseudocopies of the ATPase a-subunit gene in Oenothera mitochondria are present on different circular molecules 204 29 35 - 74.
Morikami A. Nakamura K. 1987 101 967 976 - 75.
Chaumont F. Boutry M. Briquet M. Vassarotti A. 1988 Sequence of the gene encoding the mitochondrial F1ATPase alpha subunit from Nicotiana plumbaginifolia 16 13 6247 - 76.
Schulte E. Staubach S. Laser B. Kück U. 1989 Wheat mitochondrial DNA: organization and sequences of the atpA and atp9 genes 17 18 7531 - 77.
Kadowaki K. Kazama S. Suzuki S. 1990 Nucleotide sequence of the F,-ATPase a subunit genes from rice mitochondria 18 1302 - 78.
Köhler R. H. Lössl A. Zetsche K. 1990 Nucleotide sequence of the F1ATPase alpha subunit gene of sunflower mitochondria 18 4588 - 79.
Makaroff C. A. Apel I. J. Palmer J. D. 1990 Characterization of radish mitochondrial atpA: influence of nuclear background on transcription of atpA-associated sequences and relationship with male sterility 15 5 735 746 - 80.
Siculella L. D’Ambrosio L. De Tuglie A. D. gauerani R. 1990 Minor differences in the primary structures of atpa genes coded on the mt DNA of fertile and male sterile sunflower lines 18 15 4599 - 81.
Handa H. Nakajima K. 1991 Nucleotide sequence and transcription analyses of the rapeseed (Brassica napus L.) mitochondrial F1ATPase alpha-subunit gene 16 361 364 - 82.
Chase C. D. Ortega V. M. 1992 Organization of ATPA coding and 3’ flanking sequences associated with cytoplasmic male sterility in Phaseolus vulgaris 22 147 153 - 83.
Zurawski G. Bottomley W. Whitfeld P. R. 1982 Structures of the genes for the beta and c subunits of spinach chloroplast ATPase indicates a dicistronic mRNA and an overlapping translation stop/start signal USA 79 6260 6264 - 84.
Krebbers E. T. Larrinua I. M. Mc Intosh L. Bogorad L. 1982 The maize chloroplast genes for the beta and epsilon subunits of the photosynthetic coupling factor CF1 are fused 10 16 4985 5002 - 85.
Walker J. E. Fearnley I. M. Gay N. J. Gibson B. W. Northrop F. D. Powell S. J. Runswick M. J. Saraste M. Tybulewicz V. L. J. 1985 Primary structure and subunit stoichiometry of F1-ATPase from bovine mitochondria 184 4 677 701 - 86.
Shimamoto Y. Fukushi H. Abe J. Kanazawa A. Gai J. Gao Z. Xu D. 1998 RFLPs of chloroplast and mitochondrial DNA in wild soybean, Glycine soja, growing in China 45 433 439 - 87.
Abe J. 1999 The genetic structure of natural populations of wild soybeans revealed by isozymes and RFLP’s of mitochondrial DNS’s: possible influence of seed dispersal, cross pollination and demography National Institute of Agrobiological Resources Tsukuba Ibaraki Japan 13th-15th October 143 159 - 88.
Shimamoto Y. 2001 Polymorphism and phylogeny of soybean based on chloroplast and mitochondrial DNA analysis 35 2 79 84 - 89.
Cleeg M. T. Zurawski G. 1992 Chloroplast DNA and the study of plant phylogeny New York Chapman &Hall 1 13 - 90.
Olmstead R. G. Palmer J. D. 1994 Chloroplast DNA systematics: a review of method and data analysis 81 1205 1224 - 91.
Chase M. 41others 1993 Phylogenetics of seed plants: An analysis of nucleotide sequences from the plastid gene rbcL 80 528 580 - 92.
Parkinson C. L. Adams L. Palmer D. 1999 Multigene analyses identify the three earliest lineages of extant flowering plants 9 1485 1488 - 93.
Qui Y. L. 1999 The earliest angiosperms: Evidence from mitochondrial, plastid, and nuclear genomes 402 404 407 - 94.
Soltis D. E. Soltis P. S. Doyle J. J. 1998 Molecular systematic of Plants II Boston MA Kluwer - 95.
Soltis P. S. Soltis D. E. Chase M. W. 1999 Angiosperm phylogeny inferred from multiple genes as a tool for comparative biology 402 402 404 - 96.
Kato T. Kaneko T. Sato S. Nakamura Y. Tabata S. 2000 Complete structure of the chloroplast genome of a legume, Lotus japonicus 7 323 330 - 97.
Li W. H. 1997 Sunderland Sinauer Associates 487 - 98.
Saski C.h. Lee S. B. Daniell H. Wood T. C. Tomkins J. Kim H. G. Jansen R. K. 2005 Complete chloroplast genome sequence of Glycine max and comparative analyses with other legume genomes 59 309 322 - 99.
Shinozaki K. Ohme M. Tanaka M. Wakasugi T. Hayashida N. Matsubayashi T. Zaita N. Chunwongse J. Obokata J. Yamaguchi-Shinozaki K. Ohto C. Torazawa K. Yamada K. Kusuda J. Takaiwa F. Kato A. Tohdoh N. Shimada H. Sugiura M. 1986 The complete nucleotide sequence of tobacco chloroplast genome: its gene organization and expression 5 2043 2049 - 100.
Sugiura M. Shimada H. 1991 Fine- structural features of the chloroplast genome- comparison of the sequenced chloroplast genomes 19 983 995 - 101.
Sugiura M. Sugita M. 1992 The chloroplast genome 19 149 168 - 102.
Woźny A. 1990 Warszawa Wydawnictwo Naukowe PWN - 103.
Palmer J. D. 1985 Evolution of chloroplast and mitochondrial DNA in plants and algae New York: Molecular Evolutionary Genetics Plenum Press 131 240 - 104.
Wolfe K.H. 1988 The site of deletion of the inverted repeat is pea chloroplast DNA contains duplicated gene fragments 13 97 99 - 105.
Palmer J. D. Osorio B. Aldrich J. Thompson W. F. 1987 Chloroplast DNA evolution among legumes: loss of a large inverted repeat occurred prior to other sequence rearrangements 11 275 286 - 106.
Lavin M. Doyle J. J. Palmer J. D. 1990 Evolutionary significance of the loss of the chloroplast-DNA inverted repeat in the Leguminosae subfamily Papilionoideae 44 390 402 - 107.
Herdenberger F. Pillay D. T. N. Steinmetz A. 1990 Sequence of the trnH gene and the inverted repeat structure deletion of the broad bean chloroplast genome 18 1297 - 108.
Shaw J. Lickey E. B. Beck J. T. Farmer S. B. Liu W. Miller J. Siripun K. C. Winder C. T. Schilling E. E. Small R. L. 2005 The tortoise and the here II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis 92 142 166 - 109.
Ravi V. Khurana J. P. Tyagi A. K. Khurana P. 2008 An update on chloroplast genomes 271101 122 - 110.
Kelchner S. A. 2000 The evolution of non-coding chloroplast DNA and its application in plant systematics 87 482 498 - 111.
Perry A. S. Brennan S. Murphy D. J. Wolfe K. H. 2006 Evolutionary re-organisation of a large operon in Adzuki bean chloroplast DNA caused by inverted repeat movement 9 157 162 - 112.
Close P. S. Shoemaker R. C. Keim P. 1989 Distribution of restriction site polymorphism within the chloroplast genome of the genus Glycine, subgenus Soja 77 768 776 - 113.
Xu D. H. Abe J. Kanazawa A. Sakai M. Shimamoto Y. 2000 Sequence variation of non-coding regions of chloroplast DNA of soybean and related wild species and its implications for the evolution of different chloroplast haplotypes 101 5-6 724 732 - 114.
Kajita T. Ohashi H. Tateishi Y. Bailey C. D. Doyle J. J. 2001 rbcL and legume phylogeny, with particular reference to Phaseoleae, Millettieae, and allies 26 515 536 - 115.
Nickret D. L. Patrick J. A. 1998 The nuclear ribosomal DNA intergenic spacer of wild and cultivated soybean have low variation and cryptic subrepeats 41183 192 - 116.
Palmer J. D. Adams K. L. Cho Y. Parkinson C. L. Qiu Y. L. Song K. 2000 Dynamic evolution of plant mitochondrial genomes: mobile genes and introns and highly variable mutation rates U.S.A. 97 6960 6966 - 117.
Pennington R. T. Klitgaard B. B. Ireland H. Lavin M. 2000 New insights into floral evolution of basal Papilionoideae from molecular phylogenies UK 9 233 248 - 118.
Wojciechowski M. F. Lavin M. Sanderson M. J. 2004 A phylogeny of legumes (Leguminosae) based on analysis of the plastid matK gene resolves many well-supported subclades within the family 91 1846 1862 - 119.
Taberlet P. Gielly L. Pautou G. Bouvet J. 1991 Universal primers for amplification of three non-coding regions of chloroplast DNA 17 1105 1109 - 120.
Wolfe A. D. Elisens W. J. Watson L. E. Depamphilis C. W. 1997 Using restriction-site variation of PCR-amplified cpDNA genes for phylogenetic analysis of Tribe Cheloneae (Scrophulariaceae) 84 555 564 - 121.
Sehgal D. Raina S. N. 2008 DNA markers and germplasm resource diagnostics: new perspectives in crop improvement and conservation strategies Microsoft Printech (I) Pvt. Ltd. Dehradun 39 54 - 122.
Varshney R. K. Graner A. Sorrells M. E. 2005 Genic microsatellite markers in plants: features and applications 23 48 55 - 123.
Varshney R. K. Thudi M. Aggarwal R. Börner A. 2007 Genic molecular markers in plants: development and applications Springer Dordrecht 1 13 29 - 124.
Powell W. Machray G. C. Provan J. 1996 Polymorphism revealed by simple sequence repeats 1 215 222 - 125.
Russell J. R. Fuller J. D. Macaulay M. Hatz B. G. Jahoor A. Powell W. Waugh R. 1997 Direct comparison of levels of genetic variation among barley accessions detected by RFLPs, AFLPs, SSRs and RAPDs 95 714 722 - 126.
Bohn M. Utz H. F. Melchinger A. E. 1999 Genetic similarities among winter wheat cultivars determined on the basis of RFLPs, AFLPs, and SSRs and their use for predicting progeny variance 39 228 237 - 127.
Parida S. K. Kalia S. K. Sunita K. Dalal V. Hemaprabha G. Selvi A. Pandit A. Singh A. Gaikwad K. Sharma T. R. Srivastava P. S. Singh N. K. Mohapatra T. 2009 Informative genomic microsatellite markers for efficient genotyping applications in sugarcane 118 327 338 - 128.
Shimamoto Y. Hasegawa A. Abe J. Ohara M. Mikami T. 1992 Glycine soja germplasm in Japan: isozymes and chloroplast DNA variation 19 73 77 - 129.
Xu D. H. Abe J. Gai J. Y. Shimamoto Y. 2002 Diversity of chloroplast DNA SSRs in wild and cultivated soybeans: evidence for multiple origins of cultivated soybean 105 645 653 - 130.
Xu D. H. Abe J. Kanazawa A. Gai Y. Shimamoto Y. 2001 Identification of sequence variations by PCR-RFLP and its application to the evaluation of cpDNA diversity in wild and cultivated soybeans 102 683 688 - 131.
Hirata T. Abe J. Shimamoto Y. 1996 RFLPs of chloroplast and motochondrial genomes in summer and autumn maturing cultivar groups of soybean in Kyushu district of Japan 23 107 111 - 132.
Shimamoto A. Fukushi H. Abe J. Kanazawa A. Gai J. Gao Z. Xu D. 1998 RFLPs of chloroplast and mitochondrial DNA in wild soybean, Glycine soja, growing in China 45 433 439 - 133.
Chen J. Hebert P. D. N. 1999 Directed termination of the polymerase chain reaction: kinetics and application in mutation detection 42 72 79 - 134.
Orita M. Suzuki T. S. Hayashi K. 1989 Rapid and sensitive detection of point mutation and DNA polymorphisms using the polymerase chain reaction 5 874 879 - 135.
Sarkar G. Yoon H. Sommer S. S. 1995 Dideoxy fingerprinting (ddF): a rapid and efficient screen for the presence of mutations 13 441 443 - 136.
Manen J. F. Natall A. 1995 Comparison of the evolution of ribulose- 1, 5-bisphosphate carboxylase (rbcL) and atpB-rbcL non-coding spacer sequences in a recent plant group, the tribe Rubieae (Rubiaceae) 41 920 927 - 137.
Jordan W. C. Courtney M. W. Neigel J. E. 1996 Low levels of intraspecific genetic variation at a rapidly evolving chloroplast DNA locus in North American duckweeds (Lemnaceae) 83 430 439 - 138.
Sang T. Crawford D. J. Stuessy T. F. 1997 Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae) 84 1120 1136 - 139.
Small R. L. Ryburn J. A. Cronn R. C. Seelanan T. Wendel J. F. 1998 The tortoise and the hare: choosing between noncoding plastome and nuclear Adh sequences for phylogeny reconstruction in a recently diverged plant group 85 1301 1315 - 140.
Mc Dade L. A. Moody M. L. 1999 Phylogenetic relationship among Acanthaceae: evidence from noncoding trnL-trnFF chloroplast DNA sequences 86 70 80 - 141.
Molvray M. Kores P. J. Chase M. W. 1999 Phylogenetic relationships within Korthalsella (Viscaceaek) based on nuclear ITS and plastid trnL-F sequence data 86 249 260 - 142.
Demesure B. Comps B. Petit R. J. 1996 Chloroplast DNA phylogeography of the common beach (Fagus sylvatica L.) in Europe 50 2515 2520 - 143.
Wolfe A. D. Elisens W. J. Watson L. E. Depamphilis C. W. 1997 Using restriction-site variation of PCR-amplified cpDNA genes for phylogenetic analysis of Tribe Cheloneae (Scrophulariaceae) 84 555 564 - 144.
Asmussen C. B. Liston A. 1998 Chloroplast DNA characters, phylogeny, and classification of Lathyrus (Fabaceae) 85 387 40 - 145.
Cipriani G. Testolin R. Gardner R. 1998 Restriction-site variation of PCR-amplified chloroplast DNA regions and its implication for the evolution of Actinidia 96 389 396 - 146.
Friesen N. Pollner S. Bachmann K. Blattner F. R. 1999 RAPDs and noncoding chloroplast DNA reveal a single origin of the cultivated Allium fistulosum from A. altaicum (Alliaceae) 86 554 562 - 147.
Close P. S. Shoemaker R. C. Keim P. 1989 Distribution of restriction site polymorphism within the chloroplast genome of the genus Glycine, subgenus Soja 77 768 776 - 148.
Kanazawa A. Tozuka A. Shimamoto Y. 1998 Sequence variation of chloroplast DNA that involves EcoRI and ClaI restriction site polymorphisms in soybean 73 111 119 - 149.
Downie S. R. Olmstead R. G. Zurawski G. Soltis D. E. Soltis P. S. Watson C. Palmer J. D. 1991 Six independents losses of the chloroplast DNA rpl2 intron in dicotyledons: Molecular and phylogenetic implications 45 1245 1259 - 150.
Spielmann A. Stutz E. 1983 Nucleotide sequence of soybean chloroplast DNA regions which contain the psbA and trnH genes and cover the ends of the large single-copy region and one end of the inverted repeats 11 7157 7167 - 151.
Sugiura M. Shimada H. 1991 Fine- structural features of the chloroplast genome- comparison of the sequenced chloroplast genomes 19 983 995 - 152.
Taberlet P. Coissac E. Popanon F. Gielly L. Miquel C. Valentini A. Vermat T. Corthier G. Brochmann C. Willerslev E. 2006 Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding 35 3 - 153.
Palmer J. D. 1991 Plastid chromosomes: Structure and Evolution New York Academic Press 7 5 53